Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3.1 TEV (full-length)
(Plasmid #64276)


Item Catalog # Description Quantity Price (USD)
Plasmid 64276 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5440
  • Total vector size (bp) 6150
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Tobacco etch virus (TEV) protease
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1 TEV (full-length) was a gift from Xiaokun Shu (Addgene plasmid # 64276 ; ; RRID:Addgene_64276)
  • For your References section:

    Rationally designed fluorogenic protease reporter visualizes spatiotemporal dynamics of apoptosis in vivo. To TL, Piggott BJ, Makhijani K, Yu D, Jan YN, Shu X. Proc Natl Acad Sci U S A. 2015 Mar 17;112(11):3338-43. doi: 10.1073/pnas.1502857112. Epub 2015 Mar 2. 10.1073/pnas.1502857112 PubMed 25733847