-
Depositing Lab
-
Depositing OrganizationKarolinska Institute, Dr. Nico Dantuma Lab
Located in Sweden -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11939 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 11939-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 11939-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3970
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUb-R-GFP
-
Alt nameUbiquitin
-
Alt nameUb
-
Insert Size (bp)990
-
MutationUbiquitin fused to N-terminus of GFP. Arginine at position 1 between Ub and GFP. N-end rule degradation signal.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer EGFP-N (CGTCGCCGTCCAGCTCGACCAG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX
CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to an arginine at position 1 (see article Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.
DNA (Catalog # 11939-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 11939-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ub-R-GFP was a gift from Nico Dantuma (Addgene plasmid # 11939 ; http://n2t.net/addgene:11939 ; RRID:Addgene_11939) -
For your References section:
Short-lived green fluorescent proteins for quantifying ubiquitin/proteasome-dependent proteolysis in living cells. Dantuma NP, Lindsten K, Glas R, Jellne M, Masucci MG. Nat Biotechnol. 2000 May . 18(5):538-43. 10.1038/75406 PubMed 10802622