pC0.122
(Plasmid
#119629)
-
PurposeLevel 0 Part. CDS
-
Depositing Lab
-
Depositing OrganizationUniversity of Edinburgh
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119629 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 119629-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 119629-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepICH41331
- Backbone size w/o insert (bp) 2247
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA scaffold
-
Insert Size (bp)78
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer ttgagtgagctgataccgct
- 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA scaffold derived from Streptococcus pyogenes (see Fig. 1). Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
DNA (Catalog # 119629-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 119629-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC0.122 was a gift from Alistair McCormick (Addgene plasmid # 119629 ; http://n2t.net/addgene:119629 ; RRID:Addgene_119629) -
For your References section:
CyanoGate: A Modular Cloning Suite for Engineering Cyanobacteria Based on the Plant MoClo Syntax. Vasudevan R, Gale GAR, Schiavon AA, Puzorjov A, Malin J, Gillespie MD, Vavitsas K, Zulkower V, Wang B, Howe CJ, Lea-Smith DJ, McCormick AJ. Plant Physiol. 2019 May;180(1):39-55. doi: 10.1104/pp.18.01401. Epub 2019 Feb 28. 10.1104/pp.18.01401 PubMed 30819783
