-
PurposeNme2Cas9 CMV-driven mammalian expression plasmid
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 119923-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 119923-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCDest
- Backbone size w/o insert (bp) 3300
- Total vector size (bp) 7600
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNme2Cas9
-
Alt nameNme2Cas9c
-
SpeciesN. meningitidis
-
Insert Size (bp)3300
- Promoter CMV
-
Tag
/ Fusion Protein
- NLS-3xHA-NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCACCGGCGGGCCCAAGAAGAA
- 3′ sequencing primer CATGGTGGCGCCAGCCTGCTTTTTTGTAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 119923-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 119923-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Nme2Cas9_pCDest was a gift from Erik Sontheimer (Addgene plasmid # 119923 ; http://n2t.net/addgene:119923 ; RRID:Addgene_119923) -
For your References section:
A Compact, High-Accuracy Cas9 with a Dinucleotide PAM for In Vivo Genome Editing. Edraki A, Mir A, Ibraheim R, Gainetdinov I, Yoon Y, Song CQ, Cao Y, Gallant J, Xue W, Rivera-Perez JA, Sontheimer EJ. Mol Cell. 2018 Dec 18. pii: S1097-2765(18)31033-5. doi: 10.1016/j.molcel.2018.12.003. 10.1016/j.molcel.2018.12.003 PubMed 30581144