Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #60226)


Item Catalog # Description Quantity Price (USD)
Plasmid 60226 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2597
  • Total vector size (bp) 6763
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    single guide RNA
  • Alt name
    guide RNA
  • Alt name
  • Insert Size (bp)
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Renilla luciferase
  • Alt name
  • Insert Size (bp)
  • Promoter EFS
  • Tag / Fusion Protein
    • Rluc-P2A (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGGAAAGTGATGTCGTGTACTGG
  • 3′ sequencing primer CAGCATTTTCTGCATGTTTTTCTG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Cre recombinase
  • Alt name
  • Insert Size (bp)
  • Promoter EFS
  • Tag / Fusion Protein
    • Cre-HA (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CCAATGCTATTGTTGAAGGTGCC
  • 3′ sequencing primer gtatccacatagcgtaaaaggagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Information for Cas9 mice:

JAX Stock#024857 B6.129S-Gt(ROSA)26Sor<tm1(CAG-xstpx-cas9,EGFP)Fezh>/J
Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9

JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor<tm1.1(CAG-cas9,EGFP)Fezh>/J
Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR was a gift from Feng Zhang (Addgene plasmid # 60226 ; ; RRID:Addgene_60226)
  • For your References section:

    CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. 10.1016/j.cell.2014.09.014 PubMed 25263330