This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PX552
(Plasmid #60958)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60958 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 2905
  • Total vector size (bp) 5314
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    U6_(SpaI)_sgRNA
  • Species
    Synthetic
  • Insert Size (bp)
    351
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgcgtgagggcctatttcc
  • 3′ sequencing primer gcaagtgggttttaggaccag
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Syn_EGFP-KASH
  • Species
    Synthetic
  • Insert Size (bp)
    349
  • Promoter Synapsin

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctgcgtatgagtgcaagtgggtt
  • 3′ sequencing primer ccgttggtgtaccgcagcatg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX552 was a gift from Feng Zhang (Addgene plasmid # 60958)
  • For your References section:

    In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Swiech L, Heidenreich M, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol. 2014 Oct 19. doi: 10.1038/nbt.3055. 10.1038/nbt.3055 PubMed 25326897