-
PurposepAAV-U6sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and nuclei.
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 2905
- Total vector size (bp) 5314
-
Vector typeMammalian Expression, Mouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameU6_(SpaI)_sgRNA
-
SpeciesSynthetic
-
Insert Size (bp)351
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcgtgagggcctatttcc
- 3′ sequencing primer gcaagtgggttttaggaccag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSyn_EGFP-KASH
-
SpeciesSynthetic
-
Insert Size (bp)349
- Promoter Synapsin
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgcgtatgagtgcaagtgggtt
- 3′ sequencing primer ccgttggtgtaccgcagcatg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX552 was a gift from Feng Zhang (Addgene plasmid # 60958 ; http://n2t.net/addgene:60958 ; RRID:Addgene_60958) -
For your References section:
In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Swiech L, Heidenreich M, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol. 2014 Oct 19. doi: 10.1038/nbt.3055. 10.1038/nbt.3055 PubMed 25326897