-
PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60229 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 2597
- Total vector size (bp) 6394
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesgRNA
-
Alt namesingle guide RNA
-
Alt nameguide RNA
-
Alt namegRNA
-
Insert Size (bp)100
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTC
- 3′ sequencing primer NA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCre recombinase
-
Alt nameCre
-
Insert Size (bp)1047
- Promoter CBh
-
Tag
/ Fusion Protein
- Cre-HA (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ctgagcaagaggtaagggtttaagg
- 3′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Information for Cas9 mice:
JAX Stock#024857 B6.129S-Gt(ROSA)26Sor<tm1(CAG-xstpx-cas9,EGFP)Fezh>/J
Strain Common Name: Cre-dependent Cas9 mouse; Rosa26-LSL-Cas9
(http://jaxmice.jax.org/strain/024857.html)
JAX Stock#024858 B6;129S(FVB)-Gt(ROSA)26Sor<tm1.1(CAG-cas9,EGFP)Fezh>/J
Strain Common Name: constitutively active Cas9 mouse; Rosa26-Cas9
(http://jaxmice.jax.org/strain/024858.html)
NOTE: The CBh promoter is slightly truncated. There should be no effect on function. The GC-rich region of the CBh promoter is also difficult to sequence by NGS, and this region may differ from the true sequence by a base.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR was a gift from Feng Zhang (Addgene plasmid # 60229 ; http://n2t.net/addgene:60229 ; RRID:Addgene_60229) -
For your References section:
CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. 10.1016/j.cell.2014.09.014 PubMed 25263330