Skip to main content
Addgene
Open Menu

p3x-Flag Gli3 37R3-2
(Plasmid #120305)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120305 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 120305-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 120305-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pFLAG-CMV-5.1
  • Backbone manufacturer
    Sigma
  • Backbone size w/o insert (bp) 6200
  • Total vector size (bp) 9732
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Intein 37R3-2, Gli3
  • Species
    Synthetic
  • Insert Size (bp)
    1239
  • Mutation
    Contains mutations as reported in 2011 Chemistry and Biology paper
  • Promoter CMV
  • Tag / Fusion Protein
    • 3X Flag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GGCGGGACTATGGTTGCTGACTAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3x-Flag Gli3 37R3-2 was a gift from David Liu (Addgene plasmid # 120305 ; http://n2t.net/addgene:120305 ; RRID:Addgene_120305)

  • For your References section:

    Directed evolution of a small-molecule-triggered intein with improved splicing properties in mammalian cells. Peck SH, Chen I, Liu DR. Chem Biol. 2011 May 27;18(5):619-30. doi: 10.1016/j.chembiol.2011.02.014. 10.1016/j.chembiol.2011.02.014 PubMed 21609843
Related items:
Commonly requested with: