Skip to main content

C106m
(Plasmid #121009)

  • Purpose
    MoClo golden gate assembly CD part for sfYFP-DAS (superfolder YFP with DAS degradation tag for ssrA). Please see Supplemental Documents for annotated Genbank file.
  • Depositing Lab
  • Depositing Organization
    California Institute of Technology
    Located in the United States of America
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121009 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    DVA
  • Backbone size w/o insert (bp) 2100
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sfYFP-DAS ssrA (has bbsI)
  • Species
    Synthetic
  • Insert Size (bp)
    764
  • Tag / Fusion Protein
    • DAS degradation tag for ssrA (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAATAGGCGTATCACGAGGCA
  • 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Not suitable for stage-2 Golden Gate cloning (contains internal BbsI cut site)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    C106m was a gift from Richard Murray (Addgene plasmid # 121009 ; http://n2t.net/addgene:121009 ; RRID:Addgene_121009)