C106m
(Plasmid
#121009)
-
PurposeMoClo golden gate assembly CD part for sfYFP-DAS (superfolder YFP with DAS degradation tag for ssrA). Please see Supplemental Documents for annotated Genbank file.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneDVA
- Backbone size w/o insert (bp) 2100
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfYFP-DAS ssrA (has bbsI)
-
SpeciesSynthetic
-
Insert Size (bp)764
-
Tag
/ Fusion Protein
- DAS degradation tag for ssrA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATAGGCGTATCACGAGGCA
- 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Not suitable for stage-2 Golden Gate cloning (contains internal BbsI cut site)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C106m was a gift from Richard Murray (Addgene plasmid # 121009 ; http://n2t.net/addgene:121009 ; RRID:Addgene_121009)