C109m
(Plasmid
#121011)
-
PurposeMoClo golden gate assembly CD part for mfLon-pdt3 (mfLon protease with self-targeting degradation tag pdt3). Please see Supplemental Documents for annotated Genbank file.
-
Depositing Lab
-
Depositing OrganizationCalifornia Institute of Technology
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121011 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneDVA
- Backbone size w/o insert (bp) 2100
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemfLon protease with pdt3 tag
-
SpeciesSynthetic
-
Insert Size (bp)2450
-
Tag
/ Fusion Protein
- pdt3 mfLon degradation tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATAGGCGTATCACGAGGCA
- 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C109m was a gift from Richard Murray (Addgene plasmid # 121011 ; http://n2t.net/addgene:121011 ; RRID:Addgene_121011)