Skip to main content

UC20m
(Plasmid #121040)

  • Purpose
    MoClo golden gate assembly DE part for gN2 gRNA (guide RNA for S. pyogenes Cas9; sequence designed with NUPACK for stable tracrRNA structure and open targeting region).
  • Depositing Lab
  • Depositing Organization
    California Institute of Technology
    Located in the United States of America
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 121040 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    DVA
  • Backbone size w/o insert (bp) 2100
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gN2 Cas9 gRNA UC part
  • Species
    Synthetic
  • Insert Size (bp)
    110

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAATAGGCGTATCACGAGGCA
  • 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see Supplemental Documents for annotated Genbank file.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UC20m was a gift from Richard Murray (Addgene plasmid # 121040 ; http://n2t.net/addgene:121040 ; RRID:Addgene_121040)