pUC19-U6-BssgRNA
(Plasmid
#121957)
-
PurposeMammalian expression, Genome editing, gRNA scaffold
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 121957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC19, BsaI site mutated
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBsCas12b single chimeric gRNA
-
Alt nameBsC2c1 single chimeric gRNA
-
gRNA/shRNA sequenceCCATAAGTCGACTTACATATCCGTGCGTGTGCATTATGGGCCCATCCACAGGTCTATTCCCACGGATAATCACGACTTTCCACTAAGCTTTCGAATGTTCGAAAGCTTAGTGGAAAGCTTCGTGGTTAGCAC
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-U6-BssgRNA was a gift from Wei Li (Addgene plasmid # 121957 ; http://n2t.net/addgene:121957 ; RRID:Addgene_121957) -
For your References section:
Repurposing CRISPR-Cas12b for mammalian genome engineering. Teng F, Cui T, Feng G, Guo L, Xu K, Gao Q, Li T, Li J, Zhou Q, Li W. Cell Discov. 2018 Nov 27;4:63. doi: 10.1038/s41421-018-0069-3. eCollection 2018. 10.1038/s41421-018-0069-3 PubMed 30510770