Skip to main content
Addgene
Open Menu

RFP-(SUMO)6-(SIM)10
(Plasmid #122027)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122027 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 122027-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 122027-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pC1-mCherry
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4722
  • Total vector size (bp) 7674
  • Modifications to backbone
    unknown
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    6 repeats of human SUMO3 and 10 repeats of human SUMO interactive motif (SIM) from PIASx each separated by (GGS)4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2952
  • Entrez Gene
    PIAS2 (a.k.a. ARIP3, DIP, MIZ1, PIASX, SIZ2, ZMIZ4)
  • Entrez Gene
    SUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
  • 3′ sequencing primer TGTGGGAGGTTTTTTAAAGCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RFP-(SUMO)6-(SIM)10 was a gift from Michael Rosen (Addgene plasmid # 122027 ; http://n2t.net/addgene:122027 ; RRID:Addgene_122027)

  • For your References section:

    Compositional Control of Phase-Separated Cellular Bodies. Banani SF, Rice AM, Peeples WB, Lin Y, Jain S, Parker R, Rosen MK. Cell. 2016 Jul 28;166(3):651-663. doi: 10.1016/j.cell.2016.06.010. Epub 2016 Jun 30. 10.1016/j.cell.2016.06.010 PubMed 27374333
Related items:
Commonly requested with: