RFP-(SUMO)10-(SIM)6
(Plasmid #122026)

• Purpose: Mammalian expression plasmid for multivalent scaffold of (SUMO)10-(SIM)6 biomolecular condensates to recruit SIM-containing client proteins.
• Depositing Lab: Michael Rosen
• Publication: Banani et al Cell. 2016 Jul 28;166(3):651-663. doi: 10.1016/j.cell.2016.06.010. Epub 2016 Jun 30.

Backbone

• Vector backbone: pC1-mCherry
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4722
• Total vector size (bp): 8457
• Modifications to backbone: unknown
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 10 copies of human SUMO3 and 6 repeats of human SUMO interactive motif (SIM) from PIASx separated by (GGS)4 linker
• Species: H. sapiens (human)
• Insert Size (bp): 3780
• Entrez Gene: SUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
• Entrez Gene: PIAS2 (a.k.a. ARIP3, DIP, MIZ1, PIASX, SIZ2, ZMIZ4)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspE1 (not destroyed)
• 3′ cloning site: Sal1 (not destroyed)
• 5′ sequencing primer: CCCCGTAATGCAGAAGAAGA
• 3′ sequencing primer: TGTGGGAGGTTTTTTAAAGCAAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry