pCMV-M2-TLR2-V660N
(Plasmid #12292)

• Depositing Lab: Bruce Beutler
• Depositing Organization: Scripps California (The Scripps Research Institute)
  Located in United States of America
• Publication: Jiang et al Proc Natl Acad Sci U S A. 2006 Jul 18. 103(29):10961-6.

Backbone

• Vector backbone: pFlag-CMV-1
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TLR2
• Species: M. musculus (mouse)
• Insert Size (bp): 2283
• Mutation: M82I, H202Y and V660N; signal peptide (aa1-23) replaced with preprotrypsin signal peptide
• GenBank ID: NM_011905
• Entrez Gene: Tlr2 (a.k.a. Ly105)
• Tag / Fusion Protein:
  • FLAG (FLAG-M2) (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Not I (not destroyed)
• 3′ cloning site: Bgl II (not destroyed)
• 5′ sequencing primer: accatgtctgcacttctgatc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Murine TLR2 expression vector was made by removing the original signal peptide and replacing it with the signal peptide from preprotrypsin. When compared to GenBank reference NP_036035.3, the TLR2 insert in this plasmid appears to be missing aa1-23 due to the removal of the endogenous TLR2 signal peptide. See associated publication for more information.

Also, please note that Addgene's sequencing results identified additional mutations M82I and H202Y when compared to GenBank reference NP_036035.3. M82I and H202Y are possible polymorphisms as they were also present in the wild-type TLR2 sequence from the depositing laboratory (Addgene Plasmid 12291: pCMV-M2-TLR2). It is not known whether these mutations affect TLR2 function.

DNA (Catalog # 12292-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 12292-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.