Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA3-TLR4-YFP
(Plasmid #13018)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 13018 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3-YFP
  • Backbone size w/o insert (bp) 6100
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Toll-Like Receptor 4
  • Alt name
    TLR4
  • Alt name
    TOLL
  • Alt name
    CD284
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2517
  • GenBank ID
    BC117422
  • Entrez Gene
    TLR4 (a.k.a. ARMD10, CD284, TLR-4, TOLL)
  • Tag / Fusion Protein
    • YFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer GTCTTGTAGTTGCCGTCGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The primer for sequencing out the 5' end of the GFP based constructs (GFP/EGFP, CFP, YFP) is 5'- GTCTTGTAGTTGCCGTCGTC -3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-TLR4-YFP was a gift from Doug Golenbock (Addgene plasmid # 13018 ; http://n2t.net/addgene:13018 ; RRID:Addgene_13018)