Flag-hCCDC11
(Plasmid
#122993)
-
PurposeExpresses Flag-tagged human CCDC11 in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122993 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCD-betaG-FLAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman CCDC11
-
Alt nameCFAP53
-
SpeciesH. sapiens (human)
-
Entrez GeneCFAP53 (a.k.a. CCDC11, HTX6)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A human CCDC11 cDNA was kindly provided by Dr. Moe Mahjoub at Washington University.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-hCCDC11 was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122993 ; http://n2t.net/addgene:122993 ; RRID:Addgene_122993)