SiriusGFP
(Plasmid
#123201)
-
PurposeWe have developed a variant of eGFP, SiriusGFP, that shows over a two fold increase in photostability with utility in methods requiring sustained or high intensity excitation as in 4D confocal or SIM.
-
Depositing Lab
-
Depositing OrganizationYale University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 123201-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 123201-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4016
- Total vector size (bp) 4733
-
Modifications to backboneN/A
-
Vector typeMammalian Expression, Bacterial Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSiriusGFP
-
Alt nameSiriusGFP-N1
-
Speciesjellyfish
-
Insert Size (bp)717
-
MutationeGFP-S30R/Y39N/F99S/N105T/S147R/M153T/V163A/S205V/A206K
- Promoter CMV
-
Tags
/ Fusion Proteins
- N/A
- N/A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI, BamHI, AgeI, etc. (not destroyed)
- 3′ cloning site NotI, MfeI (not destroyed)
- 5′ sequencing primer GGTTTAGTGAACCGTCAGATCC
- 3′ sequencing primer TGTTTCAGGTTCAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 123201-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 123201-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SiriusGFP was a gift from Joseph Santos-Sacchi (Addgene plasmid # 123201 ; http://n2t.net/addgene:123201 ; RRID:Addgene_123201) -
For your References section:
Seeing the long tail: A novel green fluorescent protein, SiriusGFP, for ultra long timelapse imaging. Zhong S, Rivera-Molina F, Rivetta A, Toomre D, Santos-Sacchi J, Navaratnam D. J Neurosci Methods. 2019 Feb 1;313:68-76. doi: 10.1016/j.jneumeth.2018.12.008. Epub 2018 Dec 19. 10.1016/j.jneumeth.2018.12.008 PubMed 30578868
Map uploaded by the depositor.
