-
Purposeexpression of alpha-tubulin fused to mCherry. Used for visualization of microtubules.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEYFP-alpha-tubulin
-
Backbone manufacturerTakara Bio Inc
-
Modifications to backbonemCherry substituted for EYFP
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namealpha tubulin
-
Alt nametubulin, alpha 1b
-
Alt nameα tubulin
-
Alt nameTUBA1B
-
SpeciesH. sapiens (human)
-
Entrez GeneTUBA1B (a.k.a. K-ALPHA-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCh-alpha-tubulin was a gift from Gia Voeltz (Addgene plasmid # 49149 ; http://n2t.net/addgene:49149 ; RRID:Addgene_49149) -
For your References section:
ER sliding dynamics and ER-mitochondrial contacts occur on acetylated microtubules. Friedman JR, Webster BM, Mastronarde DN, Verhey KJ, Voeltz GK. J Cell Biol. 2010 Aug 9;190(3):363-75. doi: 10.1083/jcb.200911024. 10.1083/jcb.200911024 PubMed 20696706