Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

mCh-Sec61 beta
(Plasmid #49155)


Item Catalog # Description Quantity Price (USD)
Plasmid 49155 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Modifications to backbone
    monomeric mCherry was inserted into NheI/BglII sites of pAcGFP1-C1.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    Sec61 beta
  • Alt name
  • Species
    H. sapiens (human)
  • Entrez Gene
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry* (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

*Note that the AcGFP1 is still present in this plasmid, but it is not expressed.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCh-Sec61 beta was a gift from Gia Voeltz (Addgene plasmid # 49155 ; ; RRID:Addgene_49155)
  • For your References section:

    Reticulon short hairpin transmembrane domains are used to shape ER tubules. Zurek N, Sparks L, Voeltz G. Traffic. 2011 Jan;12(1):28-41. doi: 10.1111/j.1600-0854.2010.01134.x. Epub 2010 Nov 12. 10.1111/j.1600-0854.2010.01134.x PubMed 20955502