-
Purposeexpression of Sec61 beta fused to mCherry, used as a general ER marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAcGFP1-C1
-
Backbone manufacturerClontech
-
Modifications to backbonemonomeric mCherry was inserted into NheI/BglII sites of pAcGFP1-C1.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSec61 beta
-
Alt nameSEC61B
-
SpeciesH. sapiens (human)
-
Entrez GeneSEC61B
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry* (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
*Note that the AcGFP1 is still present in this plasmid, but it is not expressed.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCh-Sec61 beta was a gift from Gia Voeltz (Addgene plasmid # 49155 ; http://n2t.net/addgene:49155 ; RRID:Addgene_49155) -
For your References section:
Reticulon short hairpin transmembrane domains are used to shape ER tubules. Zurek N, Sparks L, Voeltz G. Traffic. 2011 Jan;12(1):28-41. doi: 10.1111/j.1600-0854.2010.01134.x. Epub 2010 Nov 12. 10.1111/j.1600-0854.2010.01134.x PubMed 20955502