-
PurposeMultiplex luciferase reporter vector, with luciferase reporters for the pathways NFKB, SMAD, FOXO, P53 and AP1
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 124536-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 124536-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneOmega Destination-CMV::ELuc:bGH
-
Backbone manufacturerVenken Lab, #124528
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 13636
-
Vector typeMammalian Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert name5 copies of the NF-kb DNA binding motif
-
Alt nameTranscription Blocker + 5 copies of the NF-kb DNA binding motif + miniP+ Red Firefly luciferase
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2215
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer ACTCCACCCATTGACGTCAATGG
- 3′ sequencing primer agaatggcgccgggcctttc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name7xSMAD_RE::FLuc
-
Alt nameTranscription Blocker + 7 copies of the SMAD DNA binding motif + miniP+ Firefly luciferase
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2276
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CAAGAAGCCCGTGGCCAAGATG
- 3′ sequencing primer CGGGGTCATAAACCTTGGAAGTCATTG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert name3xDBE_BE::Renilla (FOXO)
-
Alt nameTranscription Blocker + 3 copies of the DBE DNA binding motif + miniP + Renilla luciferase
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1543
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer agggcggaaagatcgccgtg
- 3′ sequencing primer CGAAGTCCTCCAAGGTAAACACCATTG
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert name2xP53_RE::NLuc
-
Alt nameTranscription Blocker + 2 copies of the p53 DNA binding motif + miniP + NLuc luciferase
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1088
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GTCCTGAAGAACGAACAGTGAGCTTC
- 3′ sequencing primer CTGGGTCGTAGACTTTGGAAGCC
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert name6xAP-1_RE::GrRenilla
-
Alt nameTranscription Blocker + 6 copies of the AP-1 DNA binding motif + miniP + GreenRenilla luciferase
-
Insert Size (bp)1514
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer GAGGCTCTGCGAACGAATACTCG
- 3′ sequencing primer ctt ttt acg gtt cct ggc ctt ttg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 124536-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 124536-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MLRV2: NF-kb-SMAD-DBE-P53-AP1 was a gift from Koen Venken (Addgene plasmid # 124536 ; http://n2t.net/addgene:124536 ; RRID:Addgene_124536) -
For your References section:
Rapid and Efficient Synthetic Assembly of Multiplex Luciferase Reporter Plasmids for the Simultaneous Monitoring of Up to Six Cellular Signaling Pathways. Sarrion-Perdigones A, Gonzalez Y, Venken KJT. Curr Protoc Mol Biol. 2020 Jun;131(1):e121. doi: 10.1002/cpmb.121. 10.1002/cpmb.121 PubMed 32539183