pCS-CG-Lock-Cer-VWF
(Plasmid
#124828)
-
PurposeExpresses multimeric human VWF-ECFP fusion protein with A2-Lock domain The cyan fluorescence protein coding region is inserted between the VWF-D'D3 and A1 domains.
-
Depositing Lab
-
Depositing OrganizationUniversity at Buffalo (SUNY Buffalo)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124828 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 124828-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 124828-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCS-CG
- Total vector size (bp) 17094
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVWF with cyan fluorescent protein fusion between D'D3 and A1 domains and Lock A2 domain
-
SpeciesH. sapiens (human)
-
Entrez GeneVWF (a.k.a. F8VWF, VWD)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstB1 (not destroyed)
- 3′ cloning site BstBI (not destroyed)
- 5′ sequencing primer gcagagctggtttagtgaa
- 3′ sequencing primer cagcattggtagctgctgta
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 124828-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 124828-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS-CG-Lock-Cer-VWF was a gift from Sriram Neelamegham (Addgene plasmid # 124828 ; http://n2t.net/addgene:124828 ; RRID:Addgene_124828) -
For your References section:
von Willebrand factor self-association is regulated by the shear-dependent unfolding of the A2 domain. Zhang C, Kelkar A, Neelamegham S. Blood Adv. 2019 Apr 9;3(7):957-968. doi: 10.1182/bloodadvances.2018030122. 10.1182/bloodadvances.2018030122 PubMed 30936056
