pCS-CG-WT-Cer-VWF
(Plasmid #124827)

• Purpose: Expresses multimeric human VWF-ECFP fusion protein. The cyan fluorescence protein coding region is inserted between the VWF-D'D3 and A1 domains.
• Depositing Lab: Sriram Neelamegham
• Publication: Zhang et al Blood Adv. 2019 Apr 9;3(7):957-968. doi: 10.1182/bloodadvances.2018030122.

Backbone

• Vector backbone: pCS-CG
• Total vector size (bp): 17094
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: VWF with cyan fluorescent protein fusion between D'D3 and A1 domains
• Species: H. sapiens (human)
• Entrez Gene: VWF (a.k.a. F8VWF, VWD)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstB1 (not destroyed)
• 3′ cloning site: BstBI (not destroyed)
• 5′ sequencing primer: gcagagctggtttagtgaa
• 3′ sequencing primer: cagcattggtagctgctgta

Resource Information

• Supplemental Documents:
  • pCS-CG-WT-Cer-VWF.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

I471V mutation in VWF has no impact on function