Skip to main content

pCAD104_Asn152Ser_pCMV6Entry-hIRG1
(Plasmid #124877)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124877 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCMV6-Entry
  • Backbone manufacturer
    Origene
  • Backbone size w/o insert (bp) 4831
  • Total vector size (bp) 6274
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cis-aconitate decarboxylase
  • Alt name
    Irg1
  • Alt name
    CAD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1443
  • Mutation
    mutated Asn152 to Ser
  • GenBank ID
    NM_001258406
  • Entrez Gene
    ACOD1 (a.k.a. CAD, IRG1)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc and FLAG tags (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGGAAACAGCTATGACC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was generated by mutagenesis of the plasmid CAT#: RC232825 purchased from Origene.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAD104_Asn152Ser_pCMV6Entry-hIRG1 was a gift from Konrad Buessow (Addgene plasmid # 124877 ; http://n2t.net/addgene:124877 ; RRID:Addgene_124877)
  • For your References section:

    Crystal structure of cis-aconitate decarboxylase reveals the impact of naturally occurring human mutations on itaconate synthesis. Chen F, Lukat P, Iqbal AA, Saile K, Kaever V, van den Heuvel J, Blankenfeldt W, Bussow K, Pessler F. Proc Natl Acad Sci U S A. 2019 Sep 23. pii: 1908770116. doi: 10.1073/pnas.1908770116. 10.1073/pnas.1908770116 PubMed 31548418