RK5F-YAP8SA
(Plasmid
#125008)
-
Purposeexpress in mammalian cell
-
Depositing Lab
-
Depositing OrganizationAcademia Sinica
Located in Taiwan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneRK5
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYAP8SA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001130145.3
-
Entrez GeneYAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer ccactttgcctttctctcca
- 3′ sequencing primer tttgtgaaatttgtgatgctattg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byADDGENE (#33093)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RK5F-YAP8SA was a gift from Ruey-Hwa Chen (Addgene plasmid # 125008 ; http://n2t.net/addgene:125008 ; RRID:Addgene_125008) -
For your References section:
LncRNA NORAD is repressed by the YAP pathway and suppresses lung and breast cancer metastasis by sequestering S100P. Tan BS, Yang MC, Singh S, Chou YC, Chen HY, Wang MY, Wang YC, Chen RH. Oncogene. 2019 Jul;38(28):5612-5626. doi: 10.1038/s41388-019-0812-8. Epub 2019 Apr 9. 10.1038/s41388-019-0812-8 PubMed 30967631