RK5F-YAP8SA
(Plasmid #125008)

• Purpose: express in mammalian cell
• Depositing Lab: Ruey-Hwa Chen
• Publication: Tan et al Oncogene. 2019 Jul;38(28):5612-5626. doi: 10.1038/s41388-019-0812-8. Epub 2019 Apr 9.

Backbone

• Vector backbone: RK5
• Backbone size w/o insert (bp): 4700
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YAP8SA
• Species: H. sapiens (human)
• GenBank ID: NM_001130145.3
• Entrez Gene: YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: ccactttgcctttctctcca
• 3′ sequencing primer: tttgtgaaatttgtgatgctattg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ADDGENE (#33093)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry