pMJA285= pSin-TCRab-CMVp-Puro
(Plasmid #116875)

• Purpose: stable TCR expression in human T cells
• Depositing Lab: Marcos Alcocer
• Publication: Wang et al Biotechnol Lett. 2019 Oct;41(10):1095-1104. doi: 10.1007/s10529-019-02713-2. Epub 2019 Jul 26.

Backbone

• Vector backbone: pSin-EF2-Nanog-Pur
• Backbone manufacturer: James Thomson Lab
• Backbone size w/o insert (bp): 6739
• Total vector size (bp): 10035
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TCR
• Alt name: TCR alpha beta
• Alt name: bidirectional CMV Promoter
• Species: H. sapiens (human)
• Insert Size (bp): 3294
• Mutation: deletion of EF1-a promotor
• GenBank ID: MH782473
• Entrez Gene: TRAV10 (a.k.a. TCRAV10S1, TCRAV24S1)
• Entrez Gene: TRBV25-1 (a.k.a. TCRBV11S1A1T, TCRBV25S1, TRBV251)
• Promoter: CMV Promotor

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (unknown if destroyed)
• 3′ cloning site: Xbal (unknown if destroyed)
• 5′ sequencing primer: MJA424 5’TTGCGTGCCTTGAATTACTTCCACCT
• 3′ sequencing primer: MJA425 5’AATAAGGCCGGTGTGCGTTTGTCTAT

Resource Information

• Supplemental Documents:
  • genebank file 285.gb
• A portion of this plasmid was derived from a plasmid made by: Ronja Pscheid, Rui Wang, Marcos Alcocer

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The psPAX2 packaging plasmid and pMD2.G envelope plasmid can be used with this vector.