Skip to main content

pEcoCascade-IL1RNcrRNA
(Plasmid #126481)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126481 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 126481-D50 50 μg of DNA in Tris buffer $495
DNA 126481-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA
  • Total vector size (bp) 3220
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Eco IL1RN cr26
  • gRNA/shRNA sequence
    GAGGGGCAGCTCCACCCTGGGAGGGACTGT
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEcoCascade-IL1RNcrRNA was a gift from Charles Gersbach (Addgene plasmid # 126481 ; http://n2t.net/addgene:126481 ; RRID:Addgene_126481)
  • For your References section:

    Targeted transcriptional modulation with type I CRISPR-Cas systems in human cells. Pickar-Oliver A, Black JB, Lewis MM, Mutchnick KJ, Klann TS, Gilcrest KA, Sitton MJ, Nelson CE, Barrera A, Bartelt LC, Reddy TE, Beisel CL, Barrangou R, Gersbach CA. Nat Biotechnol. 2019 Sep 23. pii: 10.1038/s41587-019-0235-7. doi: 10.1038/s41587-019-0235-7. 10.1038/s41587-019-0235-7 PubMed 31548729