Skip to main content

pMGS7 (AAVS1sgRNA)
(Plasmid #126582)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126582 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 126582-D50 50 μg of DNA in Tris buffer $495
DNA 126582-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (PX458)
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48138
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AAVS1 sgRNA
  • gRNA/shRNA sequence
    GGGGCCACTAGGGACAGGAT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (unknown if destroyed)
  • 3′ cloning site Bbs1 (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/585927v2 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMGS7 (AAVS1sgRNA) was a gift from Michael Guertin (Addgene plasmid # 126582 ; http://n2t.net/addgene:126582 ; RRID:Addgene_126582)
  • For your References section:

    An improved auxin-inducible degron system preserves native protein levels and enables rapid and specific protein depletion. Sathyan KM, McKenna BD, Anderson WD, Duarte FM, Core L, Guertin MJ. Genes Dev. 2019 Oct 1;33(19-20):1441-1455. doi: 10.1101/gad.328237.119. Epub 2019 Aug 29. 10.1101/gad.328237.119 PubMed 31467088