Mouse 3' Hp1a AID GFP PuroR
(Plasmid
#127897)
-
PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Mouse Hp1a Gene
-
Depositing Lab
-
Depositing OrganizationFred Hutchinson Cancer Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127897 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 127897-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 127897-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBSK
-
Vector typeDonor plasmid
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHp1a
-
Alt nameCbx5
-
Alt nameHeterochromatin Protein 1A
-
SpeciesM. musculus (mouse), A. thaliana (mustard weed)
-
Insert Size (bp)2097
-
MutationInserting GFP AID 2A Puro into mouse 3' Hp1a
-
GenBank IDNC_000081.6
-
Entrez GeneCbx5 (a.k.a. 2610029O15Rik, HP1, Hp1a, Hp1alpha)
-
Tag
/ Fusion Protein
- GFP, AID, PuroR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgctgcaaggcgattaagttgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 127897-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 127897-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mouse 3' Hp1a AID GFP PuroR was a gift from Mark Groudine (Addgene plasmid # 127897 ; http://n2t.net/addgene:127897 ; RRID:Addgene_127897)