-
PurposeLentiviral Transfer Plasmid with mCherry-tagged mouse Trim21
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSMPP
-
Backbone manufacturerWilliam A. McEwan (MRC LMB)
- Backbone size w/o insert (bp) 10016
- Total vector size (bp) 12127
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTripartite Motif containing 21
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1428
-
GenBank ID
-
Entrez GeneTrim21 (a.k.a. Ro52, Ssa1)
- Promoter SFFV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NdeI (not destroyed)
- 5′ sequencing primer TGCTTCTCGCTTCTGTTCG
- 3′ sequencing primer ATAGCGTAAAAGGAGCAACATAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSMPP-mCherry-mTrim21 was a gift from Leo James (Addgene plasmid # 104971 ; http://n2t.net/addgene:104971 ; RRID:Addgene_104971) -
For your References section:
A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837