pCMV-GABARα1N-HA
(Plasmid
#128110)
-
PurposeExpress GABARα1 N terminal domain
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 128110-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 128110-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 3718
- Total vector size (bp) 4675
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGabra1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)727
-
GenBank IDNM_001359035.1
-
Entrez GeneGabra1 (a.k.a. GABAA-alpha1, GABAAR-alpha1, Gabra-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggacccatgacagtgctccggctaaac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 128110-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 128110-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-GABARα1N-HA was a gift from Huda Zoghbi (Addgene plasmid # 128110 ; http://n2t.net/addgene:128110 ; RRID:Addgene_128110) -
For your References section:
Neurexophilin4 is a selectively expressed alpha-neurexin ligand that modulates specific cerebellar synapses and motor functions. Meng X, McGraw CM, Wang W, Jing J, Yeh SY, Wang L, Lopez J, Brown AM, Lin T, Chen W, Xue M, Sillitoe RV, Jiang X, Zoghbi HY. Elife. 2019 Sep 16;8. pii: 46773. doi: 10.7554/eLife.46773. 10.7554/eLife.46773 PubMed 31524598