pKF-P14MMP2AG-T2APuroR-5h
(Plasmid #128256)

• Purpose: Mammalian positive feedback gene circuit in a Flp-In expression system controlling the PuroR gene. Also called mPF-PuroR.
• Depositing Lab: Gabor Balazsi
• Depositing Organization: Stony Brook University
  Located in the United States of America
• Publication: Farquhar et al Nat Commun. 2019 Jun 24;10(1):2766. doi: 10.1038/s41467-019-10330-w.

Backbone

• Vector backbone: pKF-P14MM2AG5h
• Backbone manufacturer: Custom
• Backbone size w/o insert (bp): 6246
• Total vector size (bp): 6854
• Modifications to backbone: Replaced rtTA::P2A::EGFP with insert.
• Vector type: Mammalian Expression, Synthetic Biology ; Flp-In expression vector
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rtTA-Advanced::P2A::EGFP::T2A::PuroR
• Alt name: reverse tetracycline Trans Activator (rtTA)
• Alt name: EGFP
• Alt name: PuroR
• Species: Synthetic
• Insert Size (bp): 2217
• Promoter: tight TRE promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ATATACGCGTCGAGGCCCTTTC
• 3′ sequencing primer: GCGGCCGCACCGGTTCAGGCACCGGGCTTGCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid encodes a synthetic gene circuit with positive feedback from rtTA activating the tight TRE promoter to control PuroR gene expression in an Flp-In expression vector. The custom backbone is missing the PuroR gene. We used overlap extension to replace the rtTA::P2A::EGFP fragment in the backbone with the new insert. The synthetic gene circuit is also called mPF-PuroR.

DNA (Catalog # 128256-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 128256-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.