-
PurposeFluorescence reporter to monitor ER-phagy activity
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCW57-CMV
- Backbone size w/o insert (bp) 7710
- Total vector size (bp) 9213
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namessRFPGFPKDEL
-
Insert Size (bp)1503
- Promoter CMV
-
Tag
/ Fusion Protein
- RFPGFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCATCCACGCTGTTTTGACCTC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-CMV-ssRFP-GFP-KDEL was a gift from Noboru Mizushima (Addgene plasmid # 128257 ; http://n2t.net/addgene:128257 ; RRID:Addgene_128257) -
For your References section:
Intrinsically Disordered Protein TEX264 Mediates ER-phagy. Chino H, Hatta T, Natsume T, Mizushima N. Mol Cell. 2019 Apr 11. pii: S1097-2765(19)30257-6. doi: 10.1016/j.molcel.2019.03.033. 10.1016/j.molcel.2019.03.033 PubMed 31006538