Skip to main content

pMRX-INU-FLAG-FAM134B
(Plasmid #128260)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128260 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMRX-INU-FLAG
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Backbone size w/o insert (bp) 6404
  • Total vector size (bp) 7895
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FAM134B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1491
  • GenBank ID
    NP_001030022
  • Entrez Gene
    RETREG1 (a.k.a. FAM134B, JK-1, JK1)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCATCGCAGCTTGGATACACGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    It has the pMX backbone
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRX-INU-FLAG-FAM134B was a gift from Noboru Mizushima (Addgene plasmid # 128260 ; http://n2t.net/addgene:128260 ; RRID:Addgene_128260)
  • For your References section:

    Intrinsically Disordered Protein TEX264 Mediates ER-phagy. Chino H, Hatta T, Natsume T, Mizushima N. Mol Cell. 2019 Apr 11. pii: S1097-2765(19)30257-6. doi: 10.1016/j.molcel.2019.03.033. 10.1016/j.molcel.2019.03.033 PubMed 31006538