pMTG07-Amp-FRT
(Plasmid
#128276)
-
PurposeGene circuit with the following architecture: 5xUAS-mNeonGreen--CMV-Gal4-VVD-p65
-
Depositing Lab
-
Depositing OrganizationStony Brook University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128276 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDN-D2irTN2aG5kwh
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGal4-VVD-p65
-
SpeciesSynthetic
-
Insert Size (bp)1528
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer actttccaaaatgtcgtaacaactccgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional relevant information can be found from these publciations: Nevozhay et al Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471
https://www.nature.com/articles/nmeth.1892.pdf?origin=publication_detail
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTG07-Amp-FRT was a gift from Gabor Balazsi (Addgene plasmid # 128276 ; http://n2t.net/addgene:128276 ; RRID:Addgene_128276) -
For your References section:
Noise-reducing optogenetic negative-feedback gene circuits in human cells. Guinn MT, Balazsi G. Nucleic Acids Res. 2019 Jul 3. pii: 5527975. doi: 10.1093/nar/gkz556. 10.1093/nar/gkz556 PubMed 31269201