pEYFP-N1-eKR2
(Plasmid
#115337)
-
PurposeExpresses enhanced sodium pump for light-driven extrusion of sodium; activation with green light; codon-optimized for human/mouse
-
Depositing Lab
-
Depositing OrganizationHumboldt-Universitaet zu Berlin
Located in Germany -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115337 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 115337-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 115337-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 3994
- Total vector size (bp) 5773
-
Modifications to backboneEGFP was replaced by construct with tag and targeting sequences between BamHI and XbaI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeKR2
-
SpeciesSynthetic; Dokdonia eikasta, Chlamydomonas reinhardtii
-
Mutationnone
- Promoter CMV
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer pEGFP-N1_F (GAGGTCTATATAAGCAGAGC), CMV_F (GCAAATGGGCGGTAGGCGT)
- 3′ sequencing primer pEGFP-C1_R (AACCATTATAAGCTGCAATAAAC)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 115337-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 115337-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEYFP-N1-eKR2 was a gift from Peter Hegemann (Addgene plasmid # 115337 ; http://n2t.net/addgene:115337 ; RRID:Addgene_115337) -
For your References section:
Electrical properties, substrate specificity and optogenetic potential of the engineered light-driven sodium pump eKR2. Grimm C, Silapetere A, Vogt A, Bernal Sierra YA, Hegemann P. Sci Rep. 2018 Jun 18;8(1):9316. doi: 10.1038/s41598-018-27690-w. 10.1038/s41598-018-27690-w [pii] PubMed 29915394