Skip to main content

pEYFP-N1-eKR2
(Plasmid #115337)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115337 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 115337-D50 50 μg of DNA in Tris buffer $495
DNA 115337-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 3994
  • Total vector size (bp) 5773
  • Modifications to backbone
    EGFP was replaced by construct with tag and targeting sequences between BamHI and XbaI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eKR2
  • Species
    Synthetic; Dokdonia eikasta, Chlamydomonas reinhardtii
  • Mutation
    none
  • Promoter CMV
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer pEGFP-N1_F (GAGGTCTATATAAGCAGAGC), CMV_F (GCAAATGGGCGGTAGGCGT)
  • 3′ sequencing primer pEGFP-C1_R (AACCATTATAAGCTGCAATAAAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEYFP-N1-eKR2 was a gift from Peter Hegemann (Addgene plasmid # 115337 ; http://n2t.net/addgene:115337 ; RRID:Addgene_115337)
  • For your References section:

    Electrical properties, substrate specificity and optogenetic potential of the engineered light-driven sodium pump eKR2. Grimm C, Silapetere A, Vogt A, Bernal Sierra YA, Hegemann P. Sci Rep. 2018 Jun 18;8(1):9316. doi: 10.1038/s41598-018-27690-w. 10.1038/s41598-018-27690-w [pii] PubMed 29915394