pCIneoMyc UNC119Ab
(Plasmid
#128332)
-
PurposeMammalian expression vector of Myc-tagged human UNC119A isoform b
-
Depositing Lab
-
Depositing OrganizationInstitute of Science Tokyo
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 128332-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 128332-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCIneo
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUNC119
-
SpeciesH. sapiens (human)
-
GenBank ID9094
-
Entrez GeneUNC119 (a.k.a. HRG4, IMD13, POC7, POC7A)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer gataggcacctattggtcttactgacat
- 3′ sequencing primer Gaacctgaaacataaaatgaat
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 128332-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 128332-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIneoMyc UNC119Ab was a gift from Yutaka Hata (Addgene plasmid # 128332 ; http://n2t.net/addgene:128332 ; RRID:Addgene_128332) -
For your References section:
UNC119 is a binding partner of tumor suppressor Ras-association domain family 6 and induces apoptosis and cell cycle arrest by MDM2 and p53. Iwasa H, Sarkar A, Shimizu T, Sawada T, Hossain S, Xu X, Maruyama J, Arimoto-Matsuzaki K, Withanage K, Nakagawa K, Kurihara H, Kuroyanagi H, Hata Y. Cancer Sci. 2018 Sep;109(9):2767-2780. doi: 10.1111/cas.13706. Epub 2018 Jul 28. 10.1111/cas.13706 PubMed 29931788