Skip to main content
Addgene
Open Menu

pS6-hα2M-H6
(Plasmid #128495)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128495 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 128495-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 128495-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCMV-Sport 6
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4396
  • Total vector size (bp) 8731
  • Modifications to backbone
    Introduction of Igk leader
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    A2M (G27-S1468)
  • Alt name
    CPAMD5
  • Alt name
    FWP007
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4335
  • GenBank ID
    CR749334
  • Entrez Gene
    A2M (a.k.a. A2MD, CPAMD5, FWP007, S863-7)
  • Promoter CMV
  • Tag / Fusion Protein
    • His tag (6x) (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tgggttccaggttccactggtgacggaaaaccgcagtatatggttctg
  • 3′ sequencing primer gctgagtacaatgctccttgcagccaccatcaccatcaccattaggcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pS6-hα2M-H6 was a gift from F Xavier Gomis-Ruth (Addgene plasmid # 128495 ; http://n2t.net/addgene:128495 ; RRID:Addgene_128495)

  • For your References section:

    Recombinant production of human alpha2-macroglobulin variants and interaction studies with recombinant G-related alpha2-macroglobulin binding protein and latent transforming growth factor-beta2. Marino-Puertas L, Del Amo-Maestro L, Taules M, Gomis-Ruth FX, Goulas T. Sci Rep. 2019 Jun 24;9(1):9186. doi: 10.1038/s41598-019-45712-z. 10.1038/s41598-019-45712-z PubMed 31235767
Related items:
Commonly requested with: