pS6-hα2M-H6
(Plasmid
#128495)
-
PurposeExpresses human α2M (from G27 to S1468) in mammalian cells. With C-t H6x tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCMV-Sport 6
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4396
- Total vector size (bp) 8731
-
Modifications to backboneIntroduction of Igk leader
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameA2M (G27-S1468)
-
Alt nameCPAMD5
-
Alt nameFWP007
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4335
-
GenBank IDCR749334
-
Entrez GeneA2M (a.k.a. A2MD, CPAMD5, FWP007, S863-7)
- Promoter CMV
-
Tag
/ Fusion Protein
- His tag (6x) (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tgggttccaggttccactggtgacggaaaaccgcagtatatggttctg
- 3′ sequencing primer gctgagtacaatgctccttgcagccaccatcaccatcaccattaggcg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pS6-hα2M-H6 was a gift from F Xavier Gomis-Ruth (Addgene plasmid # 128495 ; http://n2t.net/addgene:128495 ; RRID:Addgene_128495) -
For your References section:
Recombinant production of human alpha2-macroglobulin variants and interaction studies with recombinant G-related alpha2-macroglobulin binding protein and latent transforming growth factor-beta2. Marino-Puertas L, Del Amo-Maestro L, Taules M, Gomis-Ruth FX, Goulas T. Sci Rep. 2019 Jun 24;9(1):9186. doi: 10.1038/s41598-019-45712-z. 10.1038/s41598-019-45712-z PubMed 31235767