pX330-Esrrb gRNA
(Plasmid
#128841)
-
PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas technique
-
Depositing Lab
-
Depositing OrganizationHebrew University
Located in Israel -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128841 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 128841-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 128841-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX330
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEsrrb gRNA
-
gRNA/shRNA sequenceCACCGGGCCCAGCACATGGACGGA
-
SpeciesM. musculus (mouse)
-
Entrez GeneEsrrb (a.k.a. Err2, Errb, Estrrb, Nr3b2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 128841-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 128841-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-Esrrb gRNA was a gift from Yossi Buganim (Addgene plasmid # 128841 ; http://n2t.net/addgene:128841 ; RRID:Addgene_128841) -
For your References section:
Direct Induction of the Three Pre-implantation Blastocyst Cell Types from Fibroblasts. Benchetrit H, Jaber M, Zayat V, Sebban S, Pushett A, Makedonski K, Zakheim Z, Radwan A, Maoz N, Lasry R, Renous N, Inbar M, Ram O, Kaplan T, Buganim Y. Cell Stem Cell. 2019 Jun 6;24(6):983-994.e7. doi: 10.1016/j.stem.2019.03.018. Epub 2019 Apr 25. 10.1016/j.stem.2019.03.018 PubMed 31031139