-
PurposeMammalian expression vector for cloning your gene fused to mRFP
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 13032 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5446
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMonomer Red Fluorescent Protein
-
Alt namemRFP
-
Insert Size (bp)678
-
GenBank IDAF506027
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer GTCTTGTAGTTGCCGTCGTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymRFP is from Roger Tsien, UCSD.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
mRFP cloned into the old, discontinued pcDNA3 vector from Invitrogen.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-mRFP was a gift from Doug Golenbock (Addgene plasmid # 13032 ; http://n2t.net/addgene:13032 ; RRID:Addgene_13032)