pAG244 iFAST
(Plasmid
#130809)
-
PurposeExpresses iFAST in mammalian cells
-
Depositing Lab
-
Depositing OrganizationCNRS UMR 8640, Processus d'Activation Sélectif par Transfert d'Energie Uni-électronique ou Radiatif (PASTEUR)
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 4005
- Total vector size (bp) 4380
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiFAST
-
Alt nameimproved FAST
-
Alt nameimproved fluorescence-activating and absorption-shifting tag
-
Alt nameFAST2
-
gRNA/shRNA sequencex
-
SpeciesSynthetic
-
Insert Size (bp)375
- Promoter CMV
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG244 iFAST was a gift from Arnaud Gautier (Addgene plasmid # 130809 ; http://n2t.net/addgene:130809 ; RRID:Addgene_130809) -
For your References section:
Improved Chemical-Genetic Fluorescent Markers for Live Cell Microscopy. Tebo AG, Pimenta FM, Zhang Y, Gautier A. Biochemistry. 2018 Oct 2;57(39):5648-5653. doi: 10.1021/acs.biochem.8b00649. Epub 2018 Sep 17. 10.1021/acs.biochem.8b00649 PubMed 30204425