pAG328 td-iFAST
(Plasmid
#130811)
-
PurposeExpresses td-iFAST in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130811 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 4004
- Total vector size (bp) 4765
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametd-iFAST
-
Alt nametdFAST2
-
Alt nametandem iFAST, tandem FAST2
-
Alt nametandem improved fluorescence-activating and absorption-shifting tag
-
SpeciesSynthetic
-
Insert Size (bp)761
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG328 td-iFAST was a gift from Arnaud Gautier (Addgene plasmid # 130811 ; http://n2t.net/addgene:130811 ; RRID:Addgene_130811) -
For your References section:
Improved Chemical-Genetic Fluorescent Markers for Live Cell Microscopy. Tebo AG, Pimenta FM, Zhang Y, Gautier A. Biochemistry. 2018 Oct 2;57(39):5648-5653. doi: 10.1021/acs.biochem.8b00649. Epub 2018 Sep 17. 10.1021/acs.biochem.8b00649 PubMed 30204425