Skip to main content

pCMV-Sport6-CD81-pHluorin
(Plasmid #130903)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 130903 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 130903-D50 50 μg of DNA in Tris buffer $495
DNA 130903-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV-Sport6
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4360
  • Total vector size (bp) 5827
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD81-pHluorin
  • Species
    H. sapiens (human); aequorea victoria
  • Insert Size (bp)
    1467
  • Mutation
    pHluorin inserted between Leu-49 and Gly-50 in extracellular loop
  • Entrez Gene
    CD81 (a.k.a. CVID6, S5.7, TAPA1, TSPAN28)
  • Promoter CMV
  • Tag / Fusion Protein
    • pHluorin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site xbaI (not destroyed)
  • 5′ sequencing primer GAGCGGATAACAATTTCACACAGG
  • 3′ sequencing primer AATACGACTCACTATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Sport6-CD81-pHluorin was a gift from DM Pegtel (Addgene plasmid # 130903 ; http://n2t.net/addgene:130903 ; RRID:Addgene_130903)
  • For your References section:

    Quantifying exosome secretion from single cells reveals a modulatory role for GPCR signaling. Verweij FJ, Bebelman MP, Jimenez CR, Garcia-Vallejo JJ, Janssen H, Neefjes J, Knol JC, de Goeij-de Haas R, Piersma SR, Baglio SR, Verhage M, Middeldorp JM, Zomer A, van Rheenen J, Coppolino MG, Hurbain I, Raposo G, Smit MJ, Toonen RFG, van Niel G, Pegtel DM. J Cell Biol. 2018 Mar 5;217(3):1129-1142. doi: 10.1083/jcb.201703206. Epub 2018 Jan 16. 10.1083/jcb.201703206 PubMed 29339438