PX458-3xHA-SpCas9
(Plasmid
#130968)
-
Purpose3xHA tagged Cas9 from S. pyogenes with T2A-EGFP and cloning backbone for sgRNA
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePX458
- Total vector size (bp) 9310
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3xHA-NLS-SpCas9
-
Alt name3xHA-NLS-SpCas9-T2A-EGFP
-
SpeciesSynthetic; Francisella tularensis subsp. novicida
-
Insert Size (bp)406
- Promoter Cbh
-
Tags
/ Fusion Proteins
- 3x HA (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on backbone)
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CBA Forward (5' CTCCGGGCTGTAATTAGCTG 3')
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458-3xHA-SpCas9 was a gift from Debojyoti Chakraborty (Addgene plasmid # 130968 ; http://n2t.net/addgene:130968 ; RRID:Addgene_130968) -
For your References section:
Francisella novicida Cas9 interrogates genomic DNA with very high specificity and can be used for mammalian genome editing. Acharya S, Mishra A, Paul D, Ansari AH, Azhar M, Kumar M, Rauthan R, Sharma N, Aich M, Sinha D, Sharma S, Jain S, Ray A, Jain S, Ramalingam S, Maiti S, Chakraborty D. Proc Natl Acad Sci U S A. 2019 Oct 15;116(42):20959-20968. doi: 10.1073/pnas.1818461116. Epub 2019 Sep 30. 10.1073/pnas.1818461116 PubMed 31570623