Thy1.1-muSOX
(Plasmid
#131702)
-
Purposeencodes Thy1.1 followed by a P2A site and muSOX for enriching pure populations of transfected cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 131702-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 131702-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 5949
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThy1.1-muSOX
-
Alt nameCD90.1
-
Insert Size (bp)2016
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ttgtttattgcagcttataatggtt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 131702-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 131702-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Thy1.1-muSOX was a gift from Britt Glaunsinger (Addgene plasmid # 131702 ; http://n2t.net/addgene:131702 ; RRID:Addgene_131702) -
For your References section:
Changes in mRNA abundance drive shuttling of RNA binding proteins, linking cytoplasmic RNA degradation to transcription. Gilbertson S, Federspiel JD, Hartenian E, Cristea IM, Glaunsinger B. Elife. 2018 Oct 3;7. pii: 37663. doi: 10.7554/eLife.37663. 10.7554/eLife.37663 PubMed 30281021