NLS-SuperNova
(Plasmid
#131858)
-
PurposeExpresses SuperNova fused to nuclear localization signal (NLS)
-
Depositing Lab
-
Depositing OrganizationUniversity of Groningen
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131858 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerCloneTech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuperNova
-
SpeciesSynthetic
- Promoter cmv
-
Tags
/ Fusion Proteins
- Myc tag (C terminal on insert)
- c-myc nuclear localization signal (NLS) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Nuclear targeting was achieved by replacing EGFP in pEGFP-C1 with synthetic DNA coding for SuperNova with an N-terminal c-myc nuclear localization signal (NLS) using restriction sites NheI and HindIII. SuperNova sequence is from: Takemoto, K.; Matsuda, T.; Sakai, N.; Fu, D.; Noda, M.; Uchiyama, S.; Kotera, I.; Arai, Y.; Horiuchi, M.; Fukui, K.; et al. SuperNova, a monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation. Sci. Rep. 2013, 3, 2629.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NLS-SuperNova was a gift from Geert van den Bogaart (Addgene plasmid # 131858 ; http://n2t.net/addgene:131858 ; RRID:Addgene_131858) -
For your References section:
Radical Stress Is More Cytotoxic in the Nucleus than in Other Organelles. Paardekooper LM, van Vroonhoven E, Ter Beest M, van den Bogaart G. Int J Mol Sci. 2019 Aug 25;20(17). pii: ijms20174147. doi: 10.3390/ijms20174147. 10.3390/ijms20174147 PubMed 31450682