Calreticulin-SuperNova-KDEL
(Plasmid #131857)

• Purpose: Expresses SuperNova fused to ER protein calreticulin and KDEL ER-retention signal
• Depositing Lab: Geert van den Bogaart
• Publication: Paardekooper et al Int J Mol Sci. 2019 Aug 25;20(17). pii: ijms20174147. doi: 10.3390/ijms20174147.

Backbone

• Vector backbone: pcDNA3.1(+)
• Backbone manufacturer: Invitrogen
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SuperNova
• Species: Synthetic
• Promoter: CMV
• Tags / Fusion Proteins:
  • KDEL ER-retention signal (C terminal on insert)
  • Signal sequence of human calreticulin (first 18 residues) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Targeting of the ER was achieved by inserting synthetic DNA coding for the signal sequence of calreticulin (first 18 amino acids) with C-terminal SuperNova into pcDNA3.1(+) using restriction sites HindIII and XbaI. Additionally, an ER retention signal (KDEL) was added to the C-terminus of SuperNova. SuperNova sequence is from: Takemoto, K.; Matsuda, T.; Sakai, N.; Fu, D.; Noda, M.; Uchiyama, S.; Kotera, I.; Arai, Y.; Horiuchi, M.; Fukui, K.; et al. SuperNova, a monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation. Sci. Rep. 2013, 3, 2629.