Skip to main content

pGL4-eIF3B
(Plasmid #133308)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133308 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 133308-D50 50 μg of DNA in Tris buffer $495
DNA 133308-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL4.10
  • Backbone manufacturer
    promega
  • Backbone size w/o insert (bp) 4242
  • Total vector size (bp) 5829
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eIF3B promoter
  • Alt name
    PRT1; EIF3S9; EIF3-ETA; EIF3-P110; EIF3-P116
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1612
  • GenBank ID
    NM_003751 NM_001037283
  • Entrez Gene
    EIF3B (a.k.a. EIF3-ETA, EIF3-P110, EIF3-P116, EIF3S9, PRT1)
  • Promoter eIF3B

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer 5′-d(CTAGCAAAATAGGCTGTCCC)-3 or ' 5′-d(GACGATAGTCATGCCCCGCG)-3
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    genscript

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4-eIF3B was a gift from Josep Domingo-Domenech (Addgene plasmid # 133308 ; http://n2t.net/addgene:133308 ; RRID:Addgene_133308)
  • For your References section:

    Master transcription factor reprograming unleashes selective translation promoting castration resistance and immune evasion in lethal prostate cancer. Santasusagna S, Zhu S, Jawalagatti V, Carceles-Cordon M, Ertel A, Garcia-Longarte S, Song WM, Fujiwara N, Li P, Mendizabal I, Petrylak DP, Kelly WK, Reddy EP, Wang L, Schiewer MJ, Lujambio A, Karnes J, Knudsen KE, Cordon-Cardo C, Dong H, Huang H, Carracedo A, Hoshida Y, Rodriguez-Bravo V, Domingo-Domenech J. Cancer Discov. 2023 Sep 7. doi: 10.1158/2159-8290.CD-23-0306. 10.1158/2159-8290.CD-23-0306 PubMed 37676710