BII-gR-PtW-eSpCas9
(Plasmid
#133357)
-
PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expression
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 133357 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 133357-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 133357-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneBII-gR-PtW-EspCas9
-
Backbone manufacturerMadison Lab
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeSpCas9
-
gRNA/shRNA sequenceGGAGACGCTGACCCGTCTCT
-
SpeciesStaphalococcus pyogenes
-
MutationeSpCas9 mutations
- Promoter CMV enhancer and hEf1a (CpG free)
-
Tag
/ Fusion Protein
- HA-tagged eSpCas9 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.10.14.339531 for bioRxiv preprint.
DNA (Catalog # 133357-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 133357-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BII-gR-PtW-eSpCas9 was a gift from Blair Madison (Addgene plasmid # 133357 ; http://n2t.net/addgene:133357 ; RRID:Addgene_133357) -
For your References section:
The oncogenic function of PLAGL2 is mediated via ASCL2 and IGF2 and a Wnt-independent mechanism in colorectal cancer. Fischer AD, Veronese-Paniagua DA, Swaminathan S, Kashima H, Rubin DC, Madison BB. Am J Physiol Gastrointest Liver Physiol. 2023 Jun 13. doi: 10.1152/ajpgi.00058.2022. 10.1152/ajpgi.00058.2022 PubMed 37310750
