Skip to main content
Addgene
Open Menu

TfR-sfGFP-myc tag-SpyCatcher003
(Plasmid #133451)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133451 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 133451-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 133451-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pENTR4
  • Backbone size w/o insert (bp) 4766
  • Total vector size (bp) 6172
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TfR-sfGFP-myc tag-SpyCatcher003
  • Species
    Synthetic
  • Insert Size (bp)
    1410
  • Mutation
    Contains C20 and A23 mutations that improve plasma membrane display of the transferrin receptor (TfR)
  • Promoter CMV
  • Tags / Fusion Proteins
    • GSSGS (C terminal on insert)
    • myc tag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer BGHFor (GACAGACTAACAGACTGTTCCTTTCC)
  • 3′ sequencing primer BGH reverse
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TfR-sfGFP-myc tag-SpyCatcher003 was a gift from Mark Howarth (Addgene plasmid # 133451 ; http://n2t.net/addgene:133451 ; RRID:Addgene_133451)

  • For your References section:

    Approaching infinite affinity through engineering of peptide-protein interaction. Keeble AH, Turkki P, Stokes S, Khairil Anuar INA, Rahikainen R, Hytonen VP, Howarth M. Proc Natl Acad Sci U S A. 2019 Dec 10. pii: 1909653116. doi: 10.1073/pnas.1909653116. 10.1073/pnas.1909653116 PubMed 31822621
Related items:
Commonly requested with: